Information message
OK so it’s a member of the Aspergillus fumigatus complex, but which one?
This is a critically ill patient and the clinician needs a definitive species identification to optimize antifungal treatment.
For Aspergillus, sequence analysis of ITS is sufficient to identify to species complex level only. For definitive identification analysis of β-tubulin, calmodulin and actin genes is required (Samson et al. 2007; Balajee et al. 2005).
Here is your β-tubulin gene partial sequence ready to perform a pairwise sequence alignment.
tatagttgtcggggcggaatagctcgccgaagggaccggcacggacagcgtccatggtaccgggctcgagatcgaccaggacggcacgaggaa
catacttgtcgccgttggcctagtagcgagtcagaccgtgagatgttgtcaaaggagtgtagagtcgagagtttcatccacgcacctcgttgaaataga
cgttcatacgctccagctggagatcggaggagccattgtagctattatccccgtcagacacgcgtcctcttcttccttgccttacgtgtttccgccgctttctc
gattaggtcgaacttactggccagagccgtcaaggccgtgctcaccagagatggtctgcctgtagatttgttagctgatactcatgacagcgaagctga
acacatggggacagcctgctaagatgacaggtcccagtctcccatcatcctagcattgaggtggagacataccagaaa
Now copy the above sequence, go to one of the databases listed below and perform a search.
CBS Fungal Biodiversity Centre
To perform a pairwise sequence alignment use the link provided, check the disclaimer box, paste the above sequence into the “align” box, hit the “start alignment" box.
GenBank
To perform a pairwise sequence alignment use the link provided, select nucleotide blast, paste sequence into the “enter query sequence” box, select “Other” in the database section, hit the BLAST button.
Hopefully you will get the right answer.
References:
- Balajee, S.A., J.L. Gribskov, E. Hanley et al. 2005. Aspergillus lentulus sp. nov., a new sibling species of A. fumigatus. Eukaryotic Cell 4: 625-632.
- Halliday, C., S.E. Kidd, T.C. Sorrell and S. C-A. Chen. 2015. Molecular diagnostic methods for invasive fungal disease: the horizon draws nearer? Pathology 47: 257-269.
- Samson, R.A., S. Hong, S.W. Peterson et al. 2007 Polyphasic taxonomy of Aspergillus section Fumigati and its teleomorph Neosartorya. Stud. Mycol. 59: 147-203.
Back to virtual assessment